Adam Rutherford

I Boken om mennesket utforsker Adam Rutherford hvordan mye av det vi tror er spesielt for oss, ikke er det: vi er ikke den eneste arten som kommuniserer, lager verktøy, bruker ild eller har sex av andre grunner enn å lage nye versjoner av oss selv. Men evolusjonen har gjort oss i stand til å skape komplekse kulturer som overgår andre vi kan observere i naturen. Vi liker å tenke på oss selv som unike, men er det egentlig noe spesielt som skiller oss fra andre dyr? Mennesket er bare en grein på et familietre som omfatter fire milliarder år, mange forgreninger og en milliard arter. Alle disse organismene har samme opprinnelse, med et felles arvestoff. Dette paradokset – at vår biologi ikke lar seg skille fra annet liv, likevel anser vi oss som unike – er kjernen i hvem vi er.

Detta är vår kollektiva berättelse, i våra gener har vi varandras historia -födelse, död, sjukdom, krig, hungersnöd, migration och sex. Sedan forskarna löste det mänskliga genomet 2001 har det varit föremål för alla typer av påståenden, föreställningar och myter. DNA bestämmer mycket mindre om oss som individer än vi trott, men mycket mer om oss som art. I denna fängslande resa genom det expanderande genetiska landskapet avslöjas vad våra gener nu berättar om historien och vad historien berättar om våra gener. Vilka är våra förfäder? Var kom de ifrån? Genetiker har plötsligt blivit historiker, och innehållet i vår DNA har omkullkastat allt det vi trodde vi visste. Den hyllade vetenskapsjournalisten Adam Rutherford förklarar exakt hur nya genforskningen helt skriver om den mänskliga historien - från 100 000 år sedan till nutid. Han lyckas, i mitt tycke, mycket bra med att blanda lättsam humor med uppdaterade fakta från forskningsfronten. - BTJ, häfte 10, M Huss

I Boken om mennesket utforsker Adam Rutherford hvordan mye av det vi tror er spesielt for oss, ikke er det: vi er ikke den eneste arten som kommuniserer, lager verktøy, bruker ild eller har sex av andre grunner enn å lage nye versjoner av oss selv. Men evolusjonen har gjort oss i stand til å skape komplekse kulturer som overgår andre vi kan observere i naturen. Vi liker å tenke på oss selv som unike, men er det egentlig noe spesielt som skiller oss fra andre dyr? Mennesket er bare en grein på et familietre som omfatter fire milliarder år, mange forgreninger og en milliard arter. Alle disse organismene har samme opprinnelse, med et felles arvestoff. Dette paradokset – at vår biologi ikke lar seg skille fra annet liv, likevel anser vi oss som unike – er kjernen i hvem vi er.

A thrilling new examination of what sets us apart in the animal kingdom by the popular science broadcaster and author of A BRIEF HISTORY OF EVERYONE WHO EVER LIVED

Avmystifiserende og opplysende om hvem vi er og hvordan vi har blitt sånn, basert på den nyeste genforskningen gjort forståelig for hvermannsen. Dette er en historie om oss. Det er historien om hvem vi er og hvordan vi ble til. Om det som er unikt for hvert eneste menneske som noen gang har trukket pusten. Men det er også vår kollektive historie, for i hvert eneste genom bærer vi vår arts historie – fødsler, død, sykdom, krig, hungersnød, migrasjon og masse sex. I denne fengslende gjennomgangen av det voksende feltet genetikk, avslører Adam Rutherford hva genene våre forteller om vår historie som mennesker, og hva historien kan fortelle oss om våre gener. Fra neandertalere til mord, fra rødhårete til rase, døde konger til pest, evolusjon til epigenetikk – dette er en avmystifiserende og opplysende bok om et felt som er i rasende utvikling.

In our unique genomes, every one of us carries the story of our species--births, deaths, disease, war, famine, migration, and a lot of sex. But those stories have always been locked away--until now. Who are our ancestors? Where did they come from? Geneticists have suddenly become historians, and the hard evidence in our DNA has blown the lid off what we thought we knew. Acclaimed science writer Adam Rutherford explains exactly how genomics is completely rewriting the human story--from 100,000 years ago to the present.

Part of the ALL-NEW LADYBIRD EXPERT SERIES.____________Who discovered genetics? How does gene inheritance work? Is DNA common to all living things? We inherit CODES from our parents. And these codes are written in the molecule DNA. This DNA means that we RESEMBLE each other, namely our families. This raises so many questions such as how does DNA influence evolution? How was it discovered? And what does it mean for the future of the human race? Discover the answers and more inside Adam Rutherford's Ladybird Expert - Genetics, the thrilling and accessible account that explains race and genetics, whether it is our DNA or the environment that influences us most, what are our chances of being related to royalty, genetic engineering and much more . . .

Avmysterifiserende og opplysende om hvem vi er og hvordan vi har blitt sånn, basert på den nyeste genforskningen gjort forståelig for hvermannsen. Dette er en historie om oss. Det er historien om hvem vi er og hvordan vi ble til. Om det som er unikt for hvert eneste menneske som noen gang har trukket pusten. Men det er også vår kollektive historie, for i hvert eneste genom bærer vi vår arts historie - fødsler, død, sykdom, krig, hungersnød, migrasjon og masse sex. I denne fengslende gjennomgangen av det voksende feltet genetikk, avslører Adam Rutherford hva genene våre forteller om vår historie som mennesker, og hva historien kan fortelle oss om våre gener. Fra neandertalere til mord, fra rødhårete til rase, døde konger til pest, evolusjon til epigenetikk - dette er en avmystifiserende og opplysende bok om et felt som er i rasende utvikling.

A dazzling tour of the latest genetic discoveries which are blurring the boundaries between science and history - 'Brilliant, authoritative, surprising, captivating' BRIAN COX

This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.

Today's scientists are radically exceeding the boundaries of evolution and engineering entirely novel creatures. Cutting edge "synthetic biology" may lead to solutions to some of the world's most pressing crises and pave the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all--how did life begin? As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on SundayThe Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.'A superbly written explanation' Brian CoxThis same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer'The perfect primer on the past and future of DNA' Guardian'Susenseful, erudite and thrilling' Prospect'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial TimesDr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG